Review



plenti sgrb1 cre vector  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Addgene inc plenti sgrb1 cre vector
    Plenti Sgrb1 Cre Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plenti+sgrb1+cre+vector/Lenti-sgRb1%2FCre+(Plasmid+%2389647)/pmc12907852-49-6-8
    Average 94 stars, based on 3 article reviews
    plenti sgrb1 cre vector - by Bioz Stars, 2026-09
    94/100 stars

    Images

    Related Articles

    Sequencing:

    Article Title: In vivo multiplexed modeling reveals diverse roles of the TBX2 subfamily and Egr1 in Kr as -driven lung adenocarcinoma
    Article Snippet: The Lenti-U6-sgRNA-sgID-barcode-Pgk-Cre vector was cloned in collaboration with Genewiz. .. Initially, the sgRNA sequence of the pLenti-sgRb1/Cre vector (Addgene #89647) was replaced by GCGAGGTATTACCGGCGTATCATCCGCG using site-directed mutagenesis, thereby creating pLenti-BaeI-Pgk-Cre. ..

    Article Title: In Vivo Multiplexed Modeling Reveals Diverse Roles of the TBX2 Subfamily and Egr1 in Ras -Driven Lung Adenocarcinoma
    Article Snippet: The Lenti-U6-sgRNA-sgID-barcode-Pgk-Cre vector was cloned in collaboration with Genewiz. .. Initially, the sgRNA sequence of the pLenti-sgRb1/Cre vector (Addgene # #89647) was replaced by GCGAGGTATTACCGGCGTATCATCCGCG using site-directed mutagenesis, thereby creating pLenti-BaeI-Pgk-Cre. ..

    Plasmid Preparation:

    Article Title: In vivo multiplexed modeling reveals diverse roles of the TBX2 subfamily and Egr1 in Kr as -driven lung adenocarcinoma
    Article Snippet: The Lenti-U6-sgRNA-sgID-barcode-Pgk-Cre vector was cloned in collaboration with Genewiz. .. Initially, the sgRNA sequence of the pLenti-sgRb1/Cre vector (Addgene #89647) was replaced by GCGAGGTATTACCGGCGTATCATCCGCG using site-directed mutagenesis, thereby creating pLenti-BaeI-Pgk-Cre. ..

    Mutagenesis:

    Article Title: In vivo multiplexed modeling reveals diverse roles of the TBX2 subfamily and Egr1 in Kr as -driven lung adenocarcinoma
    Article Snippet: The Lenti-U6-sgRNA-sgID-barcode-Pgk-Cre vector was cloned in collaboration with Genewiz. .. Initially, the sgRNA sequence of the pLenti-sgRb1/Cre vector (Addgene #89647) was replaced by GCGAGGTATTACCGGCGTATCATCCGCG using site-directed mutagenesis, thereby creating pLenti-BaeI-Pgk-Cre. ..

    Article Title: In Vivo Multiplexed Modeling Reveals Diverse Roles of the TBX2 Subfamily and Egr1 in Ras -Driven Lung Adenocarcinoma
    Article Snippet: The Lenti-U6-sgRNA-sgID-barcode-Pgk-Cre vector was cloned in collaboration with Genewiz. .. Initially, the sgRNA sequence of the pLenti-sgRb1/Cre vector (Addgene # #89647) was replaced by GCGAGGTATTACCGGCGTATCATCCGCG using site-directed mutagenesis, thereby creating pLenti-BaeI-Pgk-Cre. ..



    Similar Products

    plenti sgrb1 cre vector  (Addgene inc)
    94
    Addgene inc plenti sgrb1 cre vector
    Plenti Sgrb1 Cre Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plenti+sgrb1+cre+vector/Lenti-sgRb1%2FCre+(Plasmid+%2389647)/pmc12907852-49-6-8
    Average 94 stars, based on 1 article reviews
    plenti sgrb1 cre vector - by Bioz Stars, 2026-09
    94/100 stars
    		  Buy from Supplier

    Image Search Results